Stem-loop sequence gga-mir-135a-3

AccessionMI0001264 (change log)
DescriptionGallus gallus miR-135a-3 stem-loop
Gene family MIPF0000028; mir-135
Literature search

8 open access papers mention gga-mir-135a-3
(10 sentences)

Stem-loop
   -----      g  --                 au          -   cu 
5'      cccucu cu  guggucuauggcuuuuu  uccuauguga uug  u
        |||||| ||  |||||||||||||||||  |||||||||| |||  u
3'      gggagg ga  caucggguaccgaaaag  gggauguacu aau  u
   ccuca      g  cu                 -c          c   cc 
Get sequence
Deep sequencing
27393 reads, 200 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr26: 2124003-2124098 [-]
intergenic
Database links

Mature sequence gga-miR-135a-5p

Accession MIMAT0001099
Sequence

16 - 

uauggcuuuuuauuccuauguga

 - 38

Get sequence
Deep sequencing75830 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-135a-3-3p

Accession MIMAT0031038
Sequence

55 - 

auguagggcgaaaagccauggg

 - 76

Get sequence
Deep sequencing2118 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).