Stem-loop sequence gga-let-7j

Accession MI0001262
Description Gallus gallus let-7j stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
---- ug         gu         --------u       g    
    g  agguaguag  uguauaguu         gguggga gga 
    |  |||||||||  |||||||||         ||||||| || u
    c  uccguuauc  acauaucaa         uuacccu ucu 
aauu cu         ug         uaguggacu       g    
Get sequence
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr26: 1591918-1592000 [-]
sense
Clustered miRNAs
< 10kb from gga-let-7j
gga-let-7k chr26: 1592118-1592200 [-]
gga-let-7j chr26: 1591918-1592000 [-]
Database links

Mature sequence gga-let-7j

Accession MIMAT0001181
Sequence

2 - 

ugagguaguagguuguauaguu

 - 23

Get sequence
Evidence by similarity; MI0000067
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).