Stem-loop sequence gga-let-7j

AccessionMI0001262 (change log)
DescriptionGallus gallus let-7j stem-loop
Gene family MIPF0000002; let-7
Literature search

45 open access papers mention gga-let-7j
(227 sentences)

Stem-loop
   ---- ug         gu         --------u       g    
5'     g  agguaguag  uguauaguu         gguggga gga 
       |  |||||||||  |||||||||         ||||||| || u
3'     c  uccguuauc  acauaucaa         uuacccu ucu 
   aauu cu         ug         uaguggacu       g    
Get sequence
Deep sequencing
12630950 reads, 1.51e+05 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr26: 1639928-1640010 [-]
intergenic
Clustered miRNAs
< 10kb from gga-let-7j
gga-let-7kchr26: 1640128-1640210 [-]
gga-let-7jchr26: 1639928-1640010 [-]
Database links

Mature sequence gga-let-7j-5p

Accession MIMAT0001181
Sequence

2 - 

ugagguaguagguuguauaguu

 - 23

Get sequence
Deep sequencing12630451 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-let-7j-3p

Accession MIMAT0026542
Sequence

59 - 

cuauacagucuauugccuuccu

 - 80

Get sequence
Deep sequencing494 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).