Stem-loop sequence gga-mir-34b

AccessionMI0001260 (change log)
DescriptionGallus gallus miR-34b stem-loop
Gene family MIPF0000039; mir-34
Literature search

7 open access papers mention gga-mir-34b
(120 sentences)

Stem-loop
         g    -gca       uag    c       accca 
5' gugcuu guuu    ggcagug   uuag ugauugu     g
   |||||| ||||    |||||||   |||| |||||||      
3' cacgga caaa    ccgucac   aauc acuaaca     c
         a    acua       uua    -       ccccg 
Get sequence
Deep sequencing
61837 reads, 940 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr24: 5539134-5539217 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-34b
gga-mir-34bchr24: 5539134-5539217 [+]
gga-mir-34cchr24: 5539871-5539944 [+]
Database links

Mature sequence gga-miR-34b-5p

Accession MIMAT0001179
Sequence

13 - 

caggcaguguaguuagcugauug

 - 35

Get sequence
Deep sequencing60339 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-34b-3p

Accession MIMAT0026540
Sequence

51 - 

aaucacuaaauucacugccauc

 - 72

Get sequence
Deep sequencing1498 reads, 4 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).