Stem-loop sequence gga-let-7a-2

AccessionMI0001259 (change log)
DescriptionGallus gallus let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

53 open access papers mention gga-let-7a-2
(267 sentences)

Stem-loop
      uu   g   u             uagaa ua a 
5' agg  gag uag agguuguauaguu     u  c c
   |||  ||| ||| |||||||||||||     |  | c
3' ucc  uuc auc uccaacaugucaa     a  g a
      -u   g   c             --uag gg a 
Get sequence
Deep sequencing
12645820 reads, 1.51e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr24: 3343196-3343267 [+]
intergenic
Clustered miRNAs
< 10kb from gga-let-7a-2
gga-mir-100chr24: 3335097-3335176 [+]
gga-mir-6675chr24: 3341724-3341832 [+]
gga-let-7a-2chr24: 3343196-3343267 [+]
Database links

Mature sequence gga-let-7a-5p

Accession MIMAT0001101
Sequence

5 - 

ugagguaguagguuguauaguu

 - 26

Get sequence
Deep sequencing38180273 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence gga-let-7a-2-3p

Accession MIMAT0031037
Sequence

50 - 

cuguacaaccuccuagcuuucc

 - 71

Get sequence
Deep sequencing282 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).