Stem-loop sequence gga-mir-30c-1

AccessionMI0001257 (change log)
DescriptionGallus gallus miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Literature search

21 open access papers mention gga-mir-30c-1
(63 sentences)

Stem-loop
   a     cu    cac         -    aca        ug gaa 
5'  ccaug  guag   guguaaaca uccu   cucucagc  u   c
    |||||  ||||   ||||||||| ||||   ||||||||  |   u
3'  gguac  cguc   cgcauuugu agga   gagggucg  g   c
   a     --    uuc         u    ---        gu gag 
Get sequence
Deep sequencing
178564 reads, 1.98e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr23: 4947355-4947443 [+]
sense
ENSGALT00000035036 ; NFYC-201; intron 4
Clustered miRNAs
< 10kb from gga-mir-30c-1
gga-mir-30echr23: 4946132-4946227 [+]
gga-mir-30c-1chr23: 4947355-4947443 [+]
Database links

Mature sequence gga-miR-30c-5p

Accession MIMAT0001137
Sequence

17 - 

uguaaacauccuacacucucagcu

 - 40

Get sequence
Deep sequencing265112 reads, 5 experiments
Evidence experimental; cloned [2-3], Northern [2], Illumina [4]
Database links
Predicted targets

Mature sequence gga-miR-30c-1-3p

Accession MIMAT0031105
Sequence

57 - 

ugggagaggauuguuuacgcc

 - 77

Get sequence
Deep sequencing45970 reads, 5 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4
" McBride D, Carre W, Law A, Clinton M Unpublished.
5
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
6
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).