Stem-loop sequence gga-mir-30e

AccessionMI0001256 (change log)
DescriptionGallus gallus miR-30e stem-loop
Gene family MIPF0000005; mir-30
Literature search

22 open access papers mention gga-mir-30e
(60 sentences)

Stem-loop
   c g       auc  u             uu           g gag  g 
5'  g ggcaguc   gc gcuguaaacaucc  gacuggaagcu u   gu u
    | |||||||   || |||||||||||||  ||||||||||| |   ||  
3'  c ucgucgg   cg cgacauuuguagg  cugacuuucgg g   cg c
   a g       --a  u             --           g --g  a 
Get sequence
Deep sequencing
5149776 reads, 6.26e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr23: 4946132-4946227 [+]
sense
ENSGALT00000035036 ; NFYC-201; intron 4
Clustered miRNAs
< 10kb from gga-mir-30e
gga-mir-30echr23: 4946132-4946227 [+]
gga-mir-30c-1chr23: 4947355-4947443 [+]
Database links

Mature sequence gga-miR-30e-5p

Accession MIMAT0001177
Sequence

19 - 

uguaaacauccuugacugg

 - 37

Get sequence
Deep sequencing4805811 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence gga-miR-30e-3p

Accession MIMAT0026538
Sequence

62 - 

uuucagucggauguuuacagc

 - 82

Get sequence
Deep sequencing343683 reads, 5 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).