Stem-loop sequence gga-mir-133c

AccessionMI0001255 (change log)
Previous IDsgga-mir-133a-3
DescriptionGallus gallus miR-133c stem-loop
Gene family MIPF0000029; mir-133
Literature search

21 open access papers mention gga-mir-133c
(87 sentences)

Stem-loop
   u    uc   g       aaa    -a        aacu 
5'  gccu  cug ggcuggu   aagg  accagauc    a
    ||||  ||| |||||||   ||||  ||||||||    c
3'  cggg  gac ucgacca   uucc  ugguuuag    a
   a    gu   g       -ac    cc        guca 
Get sequence
Deep sequencing
19848 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr23: 4357164-4357242 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-133c
gga-mir-12248chr23: 4355778-4355833 [+]
gga-mir-1bchr23: 4357025-4357088 [+]
gga-mir-133cchr23: 4357164-4357242 [+]
Database links

Mature sequence gga-miR-133c-5p

Accession MIMAT0026537
Sequence

13 - 

gcugguaaaaaggaaccagauc

 - 34

Get sequence
Deep sequencing129 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-133c-3p

Accession MIMAT0001176
Sequence

49 - 

uugguccccuucaaccagcugc

 - 70

Get sequence
Deep sequencing19716 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).