Stem-loop sequence gga-mir-1b

AccessionMI0001254 (change log)
DescriptionGallus gallus miR-1b stem-loop
Gene family MIPF0000038; mir-1
Literature search

26 open access papers mention gga-mir-1b
(163 sentences)

Stem-loop
   ---           c    gc     ugga   g 
5'    acauacuucuu auau  ccaua    guc g
      ||||||||||| ||||  |||||    |||  
3'    uguaugaagaa ugua  gguau    cgg c
   cua           u    -a     --ug   c 
Get sequence
Deep sequencing
8465547 reads, 9.05e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr23: 4357025-4357088 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1b
gga-mir-12248chr23: 4355778-4355833 [+]
gga-mir-1bchr23: 4357025-4357088 [+]
gga-mir-133cchr23: 4357164-4357242 [+]
Database links

Mature sequence gga-miR-1b-5p

Accession MIMAT0026536
Sequence

1 - 

acauacuucuucauaugcccaua

 - 23

Get sequence
Deep sequencing12 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-1b-3p

Accession MIMAT0001175
Sequence

42 - 

uggaauguuaagaaguaugua

 - 62

Get sequence
Deep sequencing8465534 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).