Stem-loop sequence gga-mir-124b

AccessionMI0001252 (change log)
Previous IDsgga-mir-124b-1
DescriptionGallus gallus miR-124b stem-loop
Gene family MIPF0000021; mir-124
Literature search

13 open access papers mention gga-mir-124b
(38 sentences)

Stem-loop
   ----------a       cg   u           aga        uaau 
5'            gccccag  uuu guguucacugc   ccuugauu    g
              |||||||  ||| |||||||||||   ||||||||    u
3'            cgggguu  aaa cguaagugacg   ggaauuag    c
   gucggguccga       ug   c           cac        caca 
Get sequence
Deep sequencing
148401 reads, 1.32e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr23: 2223486-2223578 [+]
intergenic
AADN04001795.1: 21649-21741 [+]
intergenic
AADN04018142.1: 2683-2775 [+]
intergenic
Database links

Mature sequence gga-miR-124b

Accession MIMAT0001174
Sequence

50 - 

uuaaggcacgcagugaaugcca

 - 71

Get sequence
Deep sequencing148401 reads, 5 experiments
Evidence by similarity; MI0000444
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).