Stem-loop sequence gga-mir-34a

AccessionMI0001251 (change log)
DescriptionGallus gallus miR-34a stem-loop
Gene family MIPF0000039; mir-34
Literature search

16 open access papers mention gga-mir-34a
(52 sentences)

Stem-loop
   --g     --    -  ug     uu        -   a          --gug   a 
5'    ccagc  ugug ag  uuucu  ggcagugu cuu gcugguuguu     agc a
      |||||  |||| ||  |||||  |||||||| ||| ||||||||||     |||  
3'    gguug  acac uc  gaaga  ccgucaua gaa cgacuaacga     uug u
   ccg     uu    a  gu     uc        u   -          aggaa   a 
Get sequence
Deep sequencing
4119 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr21: 3262992-3263100 [-]
intergenic
Database links

Mature sequence gga-miR-34a-5p

Accession MIMAT0001173
Sequence

21 - 

uggcagugucuuagcugguuguu

 - 43

Get sequence
Deep sequencing4067 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence gga-miR-34a-3p

Accession MIMAT0026535
Sequence

64 - 

caaucagcaaguauacugcccua

 - 86

Get sequence
Deep sequencing47 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).