Stem-loop sequence gga-mir-200a

AccessionMI0001249 (change log)
DescriptionGallus gallus miR-200a stem-loop
Gene family MIPF0000019; mir-8
Literature search

17 open access papers mention gga-mir-200a
(31 sentences)

Stem-loop
      - -    g        -             c    uuucuu 
5' ggu c cucu ugggcauc uuacuagacagug ugga      g
   ||| | |||| |||||||| ||||||||||||| ||||       
3' cca g ggga auuuguag aauggucugucac aucu      g
      a u    a        c             a    uaucua 
Get sequence
Deep sequencing
84986 reads, 1e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr21: 2591937-2592023 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-200a
gga-mir-200bchr21: 2594262-2594346 [-]
gga-mir-200achr21: 2591937-2592023 [-]
gga-mir-429chr21: 2589432-2589515 [-]
Database links

Mature sequence gga-miR-200a-5p

Accession MIMAT0026533
Sequence

14 - 

caucuuacuagacagugcugga

 - 35

Get sequence
Deep sequencing740 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-200a-3p

Accession MIMAT0001171
Sequence

52 - 

uaacacugucugguaacgaugu

 - 73

Get sequence
Deep sequencing84244 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).