Stem-loop sequence gga-mir-1a-1

AccessionMI0001247
Previous IDsgga-mir-1-1
DescriptionGallus gallus miR-1a-1 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u    g                gc     u  acc 
5'  gaga acauacuucuuuauau  ccaua ga   u
    |||| ||||||||||||||||  ||||| ||   g
3'  cuuu uguaugaagaaaugua  gguau cu   g
   a    a                -a     -  aac 
Get sequence
Deep sequencing
510136347 reads, 1.27e+05 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr20: 8472265-8472335 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1a-1
gga-mir-1a-1chr20: 8472265-8472335 [+]
gga-mir-1773chr20: 8473570-8473647 [+]
Database links

Mature sequence gga-miR-1a-1-5p

Accession MIMAT0031071
Sequence

7 - 

acauacuucuuuauaugcccaua

 - 29

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gga-miR-1a-3p

Accession MIMAT0001127
Previous IDsgga-miR-1
Sequence

46 - 

uggaauguaaagaaguaugua

 - 66

Get sequence
Deep sequencing21835510 reads, 5 experiments
Evidence experimental; Illumina [2]
Validated targets
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).