Stem-loop sequence gga-mir-1a-1

AccessionMI0001247 (change log)
Previous IDsgga-mir-1-1
DescriptionGallus gallus miR-1a-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

27 open access papers mention gga-mir-1a-1
(193 sentences)

Stem-loop
   u    g                gc     u  acc 
5'  gaga acauacuucuuuauau  ccaua ga   u
    |||| ||||||||||||||||  ||||| ||   g
3'  cuuu uguaugaagaaaugua  gguau cu   g
   a    a                -a     -  aac 
Get sequence
Deep sequencing
9112420 reads, 9.64e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 8315740-8315810 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1a-1
gga-mir-1a-1chr20: 8315740-8315810 [+]
gga-mir-1773chr20: 8317045-8317122 [+]
Database links

Mature sequence gga-miR-1a-1-5p

Accession MIMAT0031071
Sequence

7 - 

acauacuucuuuauaugcccaua

 - 29

Get sequence
Deep sequencing14 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-1a-3p

Accession MIMAT0001127
Previous IDsgga-miR-1
Sequence

46 - 

uggaauguaaagaaguaugua

 - 66

Get sequence
Deep sequencing18225317 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).