Stem-loop sequence gga-mir-219a

AccessionMI0001246 (change log)
DescriptionGallus gallus miR-219a stem-loop
Gene family MIPF0000044; mir-219
Literature search

5 open access papers mention gga-mir-219a
(14 sentences)

Stem-loop
   --       c u   u     a           -----     - u 
5'   cucugcu c gau gucca acgcaauucuu     gugcg c g
     ||||||| | ||| ||||| |||||||||||     ||||| |  
3'   gagacga g cua caggu uguguuaagaa     caugc g g
   ua       u u   -     c           ccaag     c a 
Get sequence
Deep sequencing
63453 reads, 460 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr17: 5485248-5485332 [+]
antisense
ENSGALT00000028985 ; gga-mir-219b-201; exon 1
Clustered miRNAs
< 10kb from gga-mir-219a
gga-mir-219bchr17: 5485245-5485333 [-]
gga-mir-219achr17: 5485248-5485332 [+]
Database links

Mature sequence gga-miR-219a

Accession MIMAT0001170
Sequence

10 - 

ugauuguccaaacgcaauucu

 - 30

Get sequence
Deep sequencing664 reads, 4 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).