Stem-loop sequence gga-mir-126

AccessionMI0001244 (change log)
DescriptionGallus gallus miR-126 stem-loop
Gene family MIPF0000115; mir-126
Literature search

18 open access papers mention gga-mir-126
(92 sentences)

Stem-loop
   -     ug     c           u       c cug   c 
5'  gcugg  acggc cauuauuacuu ugguacg g   uga a
    |||||  ||||| ||||||||||| ||||||| |   |||  
3'  cgacu  ugucg guaauaaugag gccaugc c   acu c
   a     gg     c           u       u -aa   u 
Get sequence
Deep sequencing
1474238 reads, 1.7e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr17: 8233313-8233396 [-]
sense
ENSGALT00000003809 ; EGFL7-201; intron 6
Database links

Mature sequence gga-miR-126-5p

Accession MIMAT0003723
Previous IDsgga-miR-126*
Sequence

14 - 

cauuauuacuuuugguacgcg

 - 34

Get sequence
Deep sequencing111016 reads, 5 experiments
Evidence experimental; cloned [2], Northern [2]
Database links
Predicted targets

Mature sequence gga-miR-126-3p

Accession MIMAT0001169
Previous IDsgga-miR-126
Sequence

51 - 

ucguaccgugaguaauaaugcgc

 - 73

Get sequence
Deep sequencing1363214 reads, 5 experiments
Evidence experimental; cloned [2], Northern [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.