Stem-loop sequence gga-mir-181a-2

AccessionMI0001243
Previous IDsgga-mir-181a
DescriptionGallus gallus miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gccaucuuuggaua       u a   u      cu       a    gagaa 
5'               gcuucag g aca ucaacg  gucggug guuu     c
                 ||||||| | ||| ||||||  ||||||| ||||      
3'               uggaguu c ugu aguugc  cagcuac caaa     u
   --------------       c a   c      --       -    aagaa 
Get sequence
Deep sequencing
538240530 reads, 1.02e+04 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr17: 9496903-9496993 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-181a-2
gga-mir-181a-2chr17: 9496903-9496993 [+]
gga-mir-181b-2chr17: 9498543-9498627 [+]
Database links

Mature sequence gga-miR-181a-5p

Accession MIMAT0001168
Previous IDsgga-miR-181a
Sequence

24 - 

aacauucaacgcugucggugagu

 - 46

Get sequence
Deep sequencing20070753 reads, 5 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).