Stem-loop sequence gga-mir-181a-2

AccessionMI0001243 (change log)
Previous IDsgga-mir-181a
DescriptionGallus gallus miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

13 open access papers mention gga-mir-181a-2
(103 sentences)

Stem-loop
   gccaucuuuggaua       u a   u      cu       a    gagaa 
5'               gcuucag g aca ucaacg  gucggug guuu     c
                 ||||||| | ||| ||||||  ||||||| ||||      
3'               uggaguu c ugu aguugc  cagcuac caaa     u
   --------------       c a   c      --       -    aagaa 
Get sequence
Deep sequencing
1689216 reads, 1.77e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr17: 9982132-9982222 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-181a-2
gga-mir-181a-2chr17: 9982132-9982222 [+]
gga-mir-181b-2chr17: 9983772-9983856 [+]
Database links

Mature sequence gga-miR-181a-5p

Accession MIMAT0001168
Previous IDsgga-miR-181a
Sequence

24 - 

aacauucaacgcugucggugagu

 - 46

Get sequence
Deep sequencing3304210 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).