Stem-loop sequence gga-mir-181b-2

AccessionMI0001242 (change log)
DescriptionGallus gallus miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

13 open access papers mention gga-mir-181b-2
(32 sentences)

Stem-loop
   cuaa   -     aucaa         cu           uucau 
5'     ugg cugca     cauucauug  gucgguggguu     u
       ||| |||||     |||||||||  |||||||||||      
3'     acc ggcgu     guaaguaac  uagucacucaa     g
   ----   a     caaac         --           cuauc 
Get sequence
Deep sequencing
248986 reads, 2.3e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr17: 9983772-9983856 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-181b-2
gga-mir-181a-2chr17: 9982132-9982222 [+]
gga-mir-181b-2chr17: 9983772-9983856 [+]
Database links

Mature sequence gga-miR-181b-5p

Accession MIMAT0001151
Sequence

16 - 

aacauucauugcugucgguggg

 - 37

Get sequence
Deep sequencing495048 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence gga-miR-181b-2-3p

Accession MIMAT0031059
Sequence

55 - 

ucacugaucaaugaaugcaaa

 - 75

Get sequence
Deep sequencing1441 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).