Stem-loop sequence gga-mir-130a

AccessionMI0001241 (change log)
DescriptionGallus gallus miR-130a stem-loop
Gene family MIPF0000034; mir-130
Literature search

10 open access papers mention gga-mir-130a
(15 sentences)

Stem-loop
   ug      u    a        uc         a  g -  a 
5'   cuguug ccag gcccuuuu  uguuguacu cu g ca u
     |||||| |||| ||||||||  ||||||||| || | ||  
3'   gacggu gguu cgggaaaa  auaacguga ga u gu u
   --      c    a        uu         c  g a  a 
Get sequence
Deep sequencing
52164 reads, 580 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr15: 407968-408050 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-130a
gga-mir-130achr15: 407968-408050 [-]
gga-mir-301achr15: 406743-406835 [-]
gga-mir-454chr15: 400264-400384 [-]
gga-mir-130bchr15: 399151-399227 [-]
Database links

Mature sequence gga-miR-130a-5p

Accession MIMAT0026532
Sequence

15 - 

gcccuuuuucuguuguacuacu

 - 36

Get sequence
Deep sequencing218 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence gga-miR-130a-3p

Accession MIMAT0001167
Sequence

52 - 

cagugcaauauuaaaagggcau

 - 73

Get sequence
Deep sequencing51946 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).