Stem-loop sequence gga-mir-301a

AccessionMI0001240 (change log)
Previous IDsgga-mir-301
DescriptionGallus gallus miR-301 stem-loop
Gene family MIPF0000034; mir-130
Literature search

4 open access papers mention gga-mir-301a
(8 sentences)

Stem-loop
   uggcu     u    cug   c         ---      a  gucugc 
5'      gcugg aucg   gcu ugacaaugu   ugcacu cu      a
        ||||| ||||   ||| |||||||||   |||||| ||       
3'      ugacc uggu   cga acuguuaua   acguga ga      c
   ----c     u    uua   a         aua      c  aauaaa 
Get sequence
Deep sequencing
7670 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr15: 406743-406835 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-301a
gga-mir-130achr15: 407968-408050 [-]
gga-mir-301achr15: 406743-406835 [-]
gga-mir-454chr15: 400264-400384 [-]
gga-mir-130bchr15: 399151-399227 [-]
Database links

Mature sequence gga-miR-301a-5p

Accession MIMAT0026531
Sequence

21 - 

ucugacaauguugcacuacu

 - 40

Get sequence
Deep sequencing49 reads, 4 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence gga-miR-301a-3p

Accession MIMAT0001166
Previous IDsgga-miR-301
Sequence

57 - 

cagugcaauaauauugucaaagcau

 - 81

Get sequence
Deep sequencing7620 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).