Stem-loop sequence gga-mir-218-2

AccessionMI0001237 (change log)
DescriptionGallus gallus miR-218-2 stem-loop
Gene family MIPF0000026; mir-218
Literature search

4 open access papers mention gga-mir-218-2
(38 sentences)

Stem-loop
   ----------- g        uuu         cu        ------g   ga 
5'            g gguuuucc   gugcuugau  aaccaugu       gua  a
              | ||||||||   |||||||||  ||||||||       |||   
3'            c ucggaagg   cacgaacug  uugguaca       cau  c
   cgucccucaua g        uac         uc        aguuaaa   aa 
Get sequence
Deep sequencing
27643 reads, 180 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 4563943-4564037 [+]
sense
ENSGALT00000002967 ; SLIT3-201; intron 14
Database links

Mature sequence gga-miR-218-5p

Accession MIMAT0001144
Sequence

12 - 

uugugcuugaucuaaccaugu

 - 32

Get sequence
Deep sequencing54394 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-218-3p

Accession MIMAT0026518
Sequence

54 - 

caugguucugucaagcaccaug

 - 75

Get sequence
Deep sequencing681 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).