Stem-loop sequence gga-mir-103-1

AccessionMI0001236 (change log)
DescriptionGallus gallus miR-103-1 stem-loop
Gene family MIPF0000024; mir-103
Literature search

8 open access papers mention gga-mir-103-1
(86 sentences)

Stem-loop
   ugc       --    u  u           c   u g a 
5'    ugccuuc  ggcu cu uacagugcugc uug u c u
      |||||||  |||| || ||||||||||| ||| | |  
3'    acggaag  ucgg ga auguuacgacg aac a g a
   guc       ua    -  c           -   u g u 
Get sequence
Deep sequencing
541089 reads, 6.56e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 4689830-4689907 [+]
sense
ENSGALT00000002931 ; PANK3-201; intron 5
Database links

Mature sequence gga-miR-103-1-5p

Accession MIMAT0031070
Sequence

9 - 

ucggcuucuuuacagugcugccuug

 - 33

Get sequence
Deep sequencing11 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-103-3p

Accession MIMAT0001145
Sequence

48 - 

agcagcauuguacagggcuauga

 - 70

Get sequence
Deep sequencing1082110 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).