Stem-loop sequence gga-mir-146a

AccessionMI0001235 (change log)
Previous IDsgga-mir-146
DescriptionGallus gallus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Literature search

19 open access papers mention gga-mir-146a
(61 sentences)

Stem-loop
   --------gu      uc    uu         a           guaau   auc 
5'           guaucc  agcu  gagaacuga uuccauggguu     uga   c
             ||||||  ||||  ||||||||| |||||||||||     |||    
3'           uauagg  ucga  uucuugacu gggguacccag     acu   u
   cuucugucuu      -u    -c         c           -----   guu 
Get sequence
Deep sequencing
3233323 reads, 4.96e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 7795767-7795865 [-]
intergenic
Database links

Mature sequence gga-miR-146a-5p

Accession MIMAT0001163
Previous IDsgga-miR-146
Sequence

16 - 

ugagaacugaauuccauggguu

 - 37

Get sequence
Deep sequencing3233093 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-146a-3p

Accession MIMAT0026529
Sequence

58 - 

acccauggggcucaguucuucag

 - 80

Get sequence
Deep sequencing226 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).