Stem-loop sequence gga-let-7d

AccessionMI0001232 (change log)
DescriptionGallus gallus let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

48 open access papers mention gga-let-7d
(225 sentences)

Stem-loop
   -auu    u       a       ug     c      uuagggcagggauu 
5'     gggc ccuagga gagguag  gguug auaguu              u
       |||| ||||||| |||||||  ||||| ||||||               
3'     uucg ggauucu uuccguc  ccaac uaucaa              u
   uuau    -       -       gu     a      uggaggaacacucg 
Get sequence
Deep sequencing
15646 reads, 100 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr12: 6091058-6091160 [-]
intergenic
Clustered miRNAs
< 10kb from gga-let-7d
gga-let-7a-1chr12: 6092517-6092606 [-]
gga-let-7fchr12: 6092103-6092189 [-]
gga-let-7dchr12: 6091058-6091160 [-]
Database links

Mature sequence gga-let-7d

Accession MIMAT0001161
Sequence

16 - 

agagguaguggguugcauagu

 - 36

Get sequence
Deep sequencing15478 reads, 5 experiments
Evidence by similarity; MI0000405
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).