Stem-loop sequence gga-mir-140

AccessionMI0001229 (change log)
DescriptionGallus gallus miR-140 stem-loop
Gene family MIPF0000085; mir-140
Literature search

13 open access papers mention gga-mir-140
(72 sentences)

Stem-loop
   ugcgucu     -       -  a             a       uu   uc 
5'        cuccg uguccug cc gugguuuuacccu ugguagg  acg  a
          ||||| ||||||| || ||||||||||||| |||||||  |||   
3'        ggggc guagggc gg caccaagauggga accaucu  ugu  u
   ------c     c       a  -             c       --   cg 
Get sequence
Deep sequencing
981478 reads, 1.19e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr11: 19310301-19310395 [+]
sense
ENSGALT00000000991 ; WWP2-201; intron 16
Database links

Mature sequence gga-miR-140-5p

Accession MIMAT0001159
Previous IDsgga-miR-140
Sequence

22 - 

agugguuuuacccuaugguag

 - 42

Get sequence
Deep sequencing84637 reads, 5 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence gga-miR-140-3p

Accession MIMAT0003722
Previous IDsgga-miR-140*
Sequence

62 - 

ccacaggguagaaccacggac

 - 82

Get sequence
Deep sequencing896830 reads, 5 experiments
Evidence experimental; cloned [2], Northern [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4
" McBride D, Carre W, Law A, Clinton M Unpublished.
5
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).