Stem-loop sequence gga-mir-138-2

AccessionMI0001228 (change log)
DescriptionGallus gallus miR-138-2 stem-loop
Gene family MIPF0000075; mir-138
Literature search

5 open access papers mention gga-mir-138-2
(12 sentences)

Stem-loop
   - u   u  ag       u     uca     --------ac   a 
5'  g ugc gc  cuggugu gugaa   ggccg          ggc a
    | ||| ||  ||||||| |||||   |||||          |||  
3'  c acg ug  gaccaca cacuu   ucggc          ucg g
   a u   u  -g       u     -ua     cuaucauccu   c 
Get sequence
Deep sequencing
43667 reads, 540 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr11: 2104525-2104607 [-]
intergenic
Database links

Mature sequence gga-miR-138-5p

Accession MIMAT0001122
Sequence

9 - 

agcugguguugugaauc

 - 25

Get sequence
Deep sequencing85932 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-138-2-3p

Accession MIMAT0031069
Sequence

58 - 

uauuucacuacaccaggguu

 - 77

Get sequence
Deep sequencing690 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).