Stem-loop sequence gga-mir-184

AccessionMI0001227 (change log)
DescriptionGallus gallus miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

3 open access papers mention gga-mir-184
(4 sentences)

Stem-loop
   ccgcucucacc         c      a c     -u  uuc 
5'            cccuuauca uuuucc g ccagc  uc   g
              ||||||||| |||||| | |||||  ||    
3'            gggaauagu aagagg c gguug  ag   c
   ----------u         c      - a     uc  ucu 
Get sequence
Deep sequencing
51984 reads, 600 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 19996770-19996843 [+]
antisense
ENSGALT00000013352 ; CTDSPL2-201; intron 1
Clustered miRNAs
< 10kb from gga-mir-184
gga-mir-184chr10: 19996770-19996843 [+]
gga-mir-184bchr10: 19996779-19996841 [-]
Database links

Mature sequence gga-miR-184-5p

Accession MIMAT0026526
Sequence

13 - 

ccuuaucacuuuuccagcccagc

 - 35

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-184-3p

Accession MIMAT0001158
Sequence

53 - 

uggacggagaacugauaagggu

 - 74

Get sequence
Deep sequencing51983 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).