miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0001226

Accession MI0001226
ID gga-mir-7-2
Description Gallus gallus miR-7-2 stem-loop
Stem-loop 
--  ac     cg       cu  a     a       u     u  au  cu 
  gg  ggccg  gugcccu  gg agacu gugauuu guugu gu  gg  c
  ||  |||||  |||||||  || ||||| ||||||| ||||| ||  ||   
  cc  ccggc  cgcggga  cc ucuga cacugaa caaca ca  cc  a
cg  --     -a       uu  g     -       -     c  --  cu
Get sequence
Genome context
Coordinates (WASHUC2) Overlapping transcripts
10: 14823525-14823623 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-7-2
gga-mir-7-2 10: 14823525-14823623 [-]
gga-mir-1720 10: 14823390-14823454 [-]
Database links
Gene family

MIPF0000022; mir-7

Mature sequence MIMAT0001157

Accession MIMAT0001157
ID gga-miR-7
Sequence

20 -  

uggaagacuagugauuuuguug

 - 41

Get sequence
Evidence experimental; cloned [2-3]
Predicted targets

References

1
"Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
McBride D, Carre W, Law A, Clinton M Unpublished.
3
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).