Stem-loop sequence gga-mir-204-2

AccessionMI0001225 (change log)
DescriptionGallus gallus miR-204-2 stem-loop
Gene family MIPF0000042; mir-204
Literature search

11 open access papers mention gga-mir-204-2
(22 sentences)

Stem-loop
   cuacu     ugugu   cug     u         ca    a     g aga 
5'      gagac     gac   ugggc ucccuuugu  uccu ugccu g   u
        |||||     |||   ||||| |||||||||  |||| ||||| |   c
3'      cucug     cug   acucg agggaaacg  aggg acgga u   a
   --cuu     -----   ucg     u         ac    -     g gac 
Get sequence
Deep sequencing
787 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 5628577-5628677 [+]
sense
ENSGALT00000006114 ; TRPM1-201; intron 6
Clustered miRNAs
< 10kb from gga-mir-204-2
gga-mir-1574chr10: 5628304-5628377 [+]
gga-mir-204-2chr10: 5628577-5628677 [+]
Database links

Mature sequence gga-miR-204

Accession MIMAT0001156
Sequence

27 - 

uucccuuugucauccuaugccu

 - 48

Get sequence
Deep sequencing1561 reads, 5 experiments
Evidence by similarity; MI0000284
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).