Stem-loop sequence gga-mir-190a

AccessionMI0001224 (change log)
Previous IDsgga-mir-190
DescriptionGallus gallus miR-190 stem-loop
Gene family MIPF0000076; mir-190
Literature search

3 open access papers mention gga-mir-190a
(3 sentences)

Stem-loop
   u       u    - ug               ua     uuau 
5'  gcaggac cugu g  auauguuugauauau  gguug    u
    ||||||| |||| |  |||||||||||||||  |||||     
3'  cguccug gaca c  uauacaaacuauaua  ucaac    u
   c       u    u cu               --     cuaa 
Get sequence
Deep sequencing
11080 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 4206001-4206085 [-]
sense
ENSGALT00000039556 ; TLN2-201; intron 53
Database links

Mature sequence gga-miR-190a-5p

Accession MIMAT0001155
Previous IDsgga-miR-190-5p
Sequence

15 - 

ugauauguuugauauauuaggu

 - 36

Get sequence
Deep sequencing11038 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-190a-3p

Accession MIMAT0026525
Previous IDsgga-miR-190-3p
Sequence

52 - 

cuauauaucaaacauauuccu

 - 72

Get sequence
Deep sequencing42 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).