Stem-loop sequence gga-mir-16-2

AccessionMI0001222 (change log)
DescriptionGallus gallus miR-16-2 stem-loop
Gene family MIPF0000006; mir-15
Literature search

22 open access papers mention gga-mir-16-2
(211 sentences)

Stem-loop
   ccuac    uc   ccu         ua        u  ag   aau 
5'      uugu  cgc   agcagcacg  aauauugg gu  uaa   a
        ||||  |||   |||||||||  |||||||| ||  |||    
3'      gacg  gcg   ucgucgugu  uuauaacc ca  auu   a
   -uaga    gu   aau         ua        c  -a   cca 
Get sequence
Deep sequencing
181407 reads, 2.34e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 22276898-22276991 [-]
sense
ENSGALT00000032997 ; SMC4-201; intron 4
Clustered miRNAs
< 10kb from gga-mir-16-2
gga-mir-15bchr9: 22277073-22277163 [-]
gga-mir-16-2chr9: 22276898-22276991 [-]
Database links

Mature sequence gga-miR-16-5p

Accession MIMAT0001116
Sequence

17 - 

uagcagcacguaaauauuggug

 - 38

Get sequence
Deep sequencing362642 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence gga-miR-16-2-3p

Accession MIMAT0031058
Sequence

60 - 

ccaauauuauugugcugcuuaa

 - 81

Get sequence
Deep sequencing49 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).