Stem-loop sequence gga-mir-181a-1

AccessionMI0001218 (change log)
Previous IDsgga-mir-213
DescriptionGallus gallus miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

13 open access papers mention gga-mir-181a-1
(105 sentences)

Stem-loop
   -----ugua      -   uc  u a   u      cu       a    gga  u 
5'          gugguu gcu  ag g aca ucaacg  gucggug guuu   au u
            |||||| |||  || | ||| ||||||  ||||||| ||||   ||  
3'          uaccaa cga  uc c ugu aguugc  cagcuac caaa   ug a
   uccuccucc      u   cc  c a   u      --       -    -ag  a 
Get sequence
Deep sequencing
1690368 reads, 1.77e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 2005169-2005272 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-181a-1
gga-mir-181a-1chr8: 2005169-2005272 [+]
gga-mir-181b-1chr8: 2005358-2005446 [+]
Database links

Mature sequence gga-miR-181a-5p

Accession MIMAT0001168
Previous IDsgga-miR-181a
Sequence

20 - 

aacauucaacgcugucggugagu

 - 42

Get sequence
Deep sequencing3304210 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence gga-miR-181a-3p

Accession MIMAT0001150
Previous IDsgga-miR-213;gga-miR-181a*
Sequence

60 - 

accaucgaccguugauuguacc

 - 81

Get sequence
Deep sequencing38253 reads, 5 experiments
Evidence by similarity; MI0000289
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).