Stem-loop sequence gga-mir-128-1

AccessionMI0001217 (change log)
Previous IDsgga-mir-128a
DescriptionGallus gallus miR-128-1 stem-loop
Gene family MIPF0000048; mir-128
Literature search

10 open access papers mention gga-mir-128-1
(42 sentences)

Stem-loop
   u    u      uuc       uaa      cu       u 
5'  gagc guugaa   ggggccg   cacugu  gagaggu u
    |||| ||||||   |||||||   ||||||  |||||||  
3'  uucg cgacuu   cucuggc   gugaca  cucuuua a
   c    u      uuu       caa      --       u 
Get sequence
Deep sequencing
111420 reads, 1.02e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 30766323-30766404 [+]
sense
ENSGALT00000019996 ; R3HDM1-201; intron 18
Database links

Mature sequence gga-miR-128-1-5p

Accession MIMAT0031096
Sequence

15 - 

cggggccguaacacugucugaga

 - 37

Get sequence
Deep sequencing354 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence gga-miR-128-3p

Accession MIMAT0001123
Previous IDsgga-miR-128b
Sequence

50 - 

ucacagugaaccggucucuuu

 - 70

Get sequence
Deep sequencing222032 reads, 5 experiments
Evidence experimental; cloned [2], Northern [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).