Stem-loop sequence gga-mir-10b

AccessionMI0001216 (change log)
DescriptionGallus gallus miR-10b stem-loop
Gene family MIPF0000033; mir-10
Literature search

18 open access papers mention gga-mir-10b
(52 sentences)

Stem-loop
   ca   c   a  a     u        a    g     c          uga   u 
5'   gaa guu uu cguug cuauauau cccu uagaa cgaauuugug   uau c
     ||| ||| || ||||| |||||||| |||| ||||| ||||||||||   |||  
3'   cuu caa aa guagc gguauaua gggg aucuu gcuuagacac   aua a
   -a   -   a  c     u        a    -     a          -ug   u 
Get sequence
Deep sequencing
2419301 reads, 3.28e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 16343590-16343699 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-10b
gga-mir-10bchr7: 16343590-16343699 [-]
gga-mir-1713chr7: 16338832-16338930 [-]
Database links

Mature sequence gga-miR-10b-5p

Accession MIMAT0001148
Sequence

27 - 

uacccuguagaaccgaauuugu

 - 48

Get sequence
Deep sequencing2417596 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-10b-3p

Accession MIMAT0026521
Sequence

68 - 

agauucgauucuaggggaaua

 - 88

Get sequence
Deep sequencing1508 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).