Stem-loop sequence gga-mir-107

AccessionMI0001215 (change log)
DescriptionGallus gallus miR-107 stem-loop
Gene family MIPF0000024; mir-103
Literature search

10 open access papers mention gga-mir-107
(51 sentences)

Stem-loop
   c   u      --c    u  u           c   u   a 
5'  ucu ugcuuu   agcu cu uacaguguugc uug ggc u
    ||| ||||||   |||| || ||||||||||| ||| ||| g
3'  agg acgaaa   ucgg ga auguuacgacg aac uug g
   -   u      cua    -  c           -   -   a 
Get sequence
Deep sequencing
537241 reads, 6.56e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr6: 19401516-19401596 [-]
sense
ENSGALT00000010382 ; PANK1-201; intron 4
Database links

Mature sequence gga-miR-107-5p

Accession MIMAT0026520
Sequence

13 - 

agcuucuuuacaguguugccuug

 - 35

Get sequence
Deep sequencing18 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-107-3p

Accession MIMAT0001147
Sequence

50 - 

agcagcauuguacagggcuauca

 - 72

Get sequence
Deep sequencing537213 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).