Stem-loop sequence gga-mir-203a

AccessionMI0001214 (change log)
Previous IDsgga-mir-203
DescriptionGallus gallus miR-203 stem-loop
Gene family MIPF0000108; mir-203
Literature search

17 open access papers mention gga-mir-203a
(165 sentences)

Stem-loop
   -----   -a     c     gc         u    g    a     cuc 
5'      cuc  gccuc uuggu  agugguucu aaca uuca caguu   u
        |||  ||||| |||||  ||||||||| |||| |||| |||||   a
3'      ggg  cggag gacca  ucaccagga uugu aagu guuaa   u
   gcuac   cc     c     gu         u    a    -     uac 
Get sequence
Deep sequencing
6023 reads, 520 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 50769283-50769380 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-203a
gga-mir-203bchr5: 50769282-50769373 [-]
gga-mir-203achr5: 50769283-50769380 [+]
Database links

Mature sequence gga-miR-203a

Accession MIMAT0001146
Previous IDsgga-miR-203
Sequence

56 - 

gugaaauguuuaggaccacuug

 - 77

Get sequence
Deep sequencing6013 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.