Stem-loop sequence gga-mir-103-2

AccessionMI0001213 (change log)
DescriptionGallus gallus miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Literature search

8 open access papers mention gga-mir-103-2
(86 sentences)

Stem-loop
   u      g      --   u  u           c   uu   u 
5'  cucugu cuuuca  gcu cu uacagugcugc uug  gcg u
    |||||| ||||||  ||| || ||||||||||| |||  |||  
3'  gagaca gaaagu  cgg ga auguuacgacg aac  ugu c
   -      a      au   -  c           -   --   a 
Get sequence
Deep sequencing
541056 reads, 6.56e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 89095068-89095150 [-]
sense
ENSGALT00000025750 ; PANK2-201; intron 5
Database links

Mature sequence gga-miR-103-2-5p

Accession MIMAT0026519
Sequence

14 - 

agcuucuuuacagugcugccuug

 - 36

Get sequence
Deep sequencing22 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-103-3p

Accession MIMAT0001145
Sequence

51 - 

agcagcauuguacagggcuauga

 - 73

Get sequence
Deep sequencing1082110 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).