Stem-loop sequence gga-mir-302a

AccessionMI0001211 (change log)
Previous IDsgga-mir-302
DescriptionGallus gallus miR-302a stem-loop
Gene family MIPF0000071; mir-302
Literature search

6 open access papers mention gga-mir-302a
(14 sentences)

Stem-loop
      ca   u         u ug   g    gu 
5' cca  acu aaaugugga g  cuu cuuu  u
   |||  ||| ||||||||| |  ||| ||||  c
3' ggu  uga uuuguaccu c  gaa gaaa  u
      ag   u         u gu   a    ag 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 57456844-57456910 [+]
antisense
ENSGALT00000019679 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from gga-mir-302a
gga-mir-302bchr4: 57456279-57456350 [+]
gga-mir-302cchr4: 57456541-57456605 [+]
gga-mir-1811chr4: 57456663-57456743 [+]
gga-mir-302achr4: 57456844-57456910 [+]
gga-mir-302dchr4: 57457179-57457247 [+]
gga-mir-367chr4: 57457315-57457387 [+]
Database links

Mature sequence gga-miR-302a

Accession MIMAT0001143
Previous IDsgga-miR-302
Sequence

43 - 

aagugcuuccauguuuuaguga

 - 64

Get sequence
Evidence by similarity; MI0000738
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).