Stem-loop sequence gga-mir-18b

AccessionMI0001209 (change log)
DescriptionGallus gallus miR-18b stem-loop
Gene family MIPF0000001; mir-17
Literature search

3 open access papers mention gga-mir-18b
(4 sentences)

Stem-loop
   cgugguc         --   u    c   u     ua  --g     
5'        cuuguguua  agg gcau uag gcagu  gu   acgu 
          |||||||||  ||| |||| ||| |||||  ||   ||| a
3'        gaacacggu  ucc cgua auc cguca  ua   ugcg 
   -------         cu   u    a   c     uc  aga     
Get sequence
Deep sequencing
11175 reads, 120 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 3995020-3995103 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-18b
gga-mir-106chr4: 3995151-3995231 [-]
gga-mir-18bchr4: 3995020-3995103 [-]
gga-mir-20bchr4: 3994839-3994923 [-]
gga-mir-19b-2chr4: 3994707-3994789 [-]
gga-mir-92-2chr4: 3994560-3994640 [-]
gga-mir-363chr4: 3994409-3994515 [-]
Database links

Mature sequence gga-miR-18b-5p

Accession MIMAT0001141
Sequence

15 - 

uaaggugcaucuagugcaguua

 - 36

Get sequence
Deep sequencing10718 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Predicted targets

Mature sequence gga-miR-18b-3p

Accession MIMAT0026516
Sequence

55 - 

uacugcccuaaaugcuccuucuggc

 - 79

Get sequence
Deep sequencing455 reads, 5 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).