Stem-loop sequence gga-mir-223

AccessionMI0001208 (change log)
DescriptionGallus gallus miR-223 stem-loop
Gene family MIPF0000067; mir-223
Literature search

17 open access papers mention gga-mir-223
(138 sentences)

Stem-loop
   ----cu   -    ag    gcgu              gaguuu       a u 
5'       gca gugc  cacu    guauuugacaagcu      gacacuc g c
         ||| ||||  ||||    ||||||||||||||      ||||||| | u
3'       cgu cacg  guga    cauaaacuguuuga      cugugag c g
   acgagu   u    ga    accc              ------       a g 
Get sequence
Deep sequencing
2305 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 249565-249664 [+]
intergenic
Database links

Mature sequence gga-miR-223

Accession MIMAT0001140
Sequence

59 - 

ugucaguuugucaaauacccc

 - 79

Get sequence
Deep sequencing2237 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.