Stem-loop sequence gga-mir-206

AccessionMI0001207 (change log)
DescriptionGallus gallus miR-206 stem-loop
Gene family MIPF0000038; mir-1
Literature search

20 open access papers mention gga-mir-206
(184 sentences)

Stem-loop
   ------     g                cc     -   au 
5'       gagau acaugcuucuuuauau  ccaua ugg  u
         ||||| ||||||||||||||||  ||||| |||   
3'       cuuug ugugugaaggaaugua  gguau guc  a
   gaggga     g                -a     c   gg 
Get sequence
Deep sequencing
7782 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 108045182-108045257 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-206
gga-mir-206chr3: 108045182-108045257 [-]
gga-mir-133bchr3: 108040385-108040468 [-]
Database links

Mature sequence gga-miR-206

Accession MIMAT0001139
Sequence

45 - 

uggaauguaaggaagugugugg

 - 66

Get sequence
Deep sequencing7782 reads, 5 experiments
Evidence by similarity; MI0000490
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).