Stem-loop sequence gga-mir-133b

AccessionMI0001206 (change log)
DescriptionGallus gallus miR-133b stem-loop
Gene family MIPF0000029; mir-133
Literature search

22 open access papers mention gga-mir-133b
(90 sentences)

Stem-loop
   ------- u     c        ca  c  a        cgucu  u 
5'        c cugcu uggcuggu  aa gg accaagcc     uc u
          | ||||| ||||||||  || || ||||||||     ||  
3'        g gacga aucgacca  uu cc ugguuugg     ag c
   aaaaguu u     u        ac  c  c        -----  g 
Get sequence
Deep sequencing
19017 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 108040385-108040468 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-133b
gga-mir-206chr3: 108045182-108045257 [-]
gga-mir-133bchr3: 108040385-108040468 [-]
Database links

Mature sequence gga-miR-133b

Accession MIMAT0001138
Sequence

49 - 

uugguccccuucaaccagcua

 - 69

Get sequence
Deep sequencing19016 reads, 5 experiments
Evidence by similarity; MI0000822
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).