Stem-loop sequence gga-mir-30a

AccessionMI0001204 (change log)
DescriptionGallus gallus miR-30a stem-loop
Gene family MIPF0000005; mir-30
Literature search

27 open access papers mention gga-mir-30a
(66 sentences)

Stem-loop
      a            uc           g gaagc 
5' gcg cuguaaacaucc  gacuggaagcu u     a
   ||| ||||||||||||  ||||||||||| |      
3' cgu gacguuuguagg  cugacuuucgg g     g
      c            --           g uagac 
Get sequence
Deep sequencing
6411658 reads, 7.95e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 82629084-82629155 [+]
sense
ENSGALT00000029026 ; gga-mir-30a-201; exon 1
Database links

Mature sequence gga-miR-30a-5p

Accession MIMAT0001135
Sequence

6 - 

uguaaacauccucgacuggaag

 - 27

Get sequence
Deep sequencing6068357 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence gga-miR-30a-3p

Accession MIMAT0001136
Sequence

48 - 

cuuucagucggauguuugcagc

 - 69

Get sequence
Deep sequencing343297 reads, 5 experiments
Evidence by similarity; MI0000088
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).