Stem-loop sequence gga-mir-215

AccessionMI0001203 (change log)
DescriptionGallus gallus miR-215 stem-loop
Gene family MIPF0000063; mir-192
Literature search

11 open access papers mention gga-mir-215
(26 sentences)

Stem-loop
   uc    a   cu    uc     a a  a     -   u      acu  uuuc 
5'   agua gaa  ggug  cagga a ug ccuau gaa ugacag   gc    a
     |||| |||  ||||  ||||| | || ||||| ||| ||||||   ||    a
3'   ucau cuu  ucac  gucuu u ac ggaua cuu acuguc   cg    a
   -u    c   -u    gu     a a  c     u   u      ---  ugua 
Get sequence
Deep sequencing
9557 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 18823159-18823263 [+]
antisense
ENSGALT00000015581 ; IARS2-201; intron 12
Clustered miRNAs
< 10kb from gga-mir-215
gga-mir-194chr3: 18822853-18822927 [+]
gga-mir-215chr3: 18823159-18823263 [+]
Database links

Mature sequence gga-miR-215-5p

Accession MIMAT0001134
Sequence

26 - 

augaccuaugaauugacagac

 - 46

Get sequence
Deep sequencing9557 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-215-3p

Accession MIMAT0026514
Sequence

62 - 

ccugucauuucuauaggccaaua

 - 84

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).