Stem-loop sequence gga-mir-194

AccessionMI0001202 (change log)
DescriptionGallus gallus miR-194 stem-loop
Gene family MIPF0000055; mir-194
Literature search

7 open access papers mention gga-mir-194
(114 sentences)

Stem-loop
   uggug  c   uau         a      g    cuac 
5'      cu uca   guaacagca cuccau ugga    a
        || |||   ||||||||| |||||| ||||    c
3'      ga agu   cauugucgu gaggug accu    u
   -----  u   uuu         a      -    ucag 
Get sequence
Deep sequencing
218 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 18822853-18822927 [+]
antisense
ENSGALT00000015581 ; IARS2-201; intron 12
Clustered miRNAs
< 10kb from gga-mir-194
gga-mir-194chr3: 18822853-18822927 [+]
gga-mir-215chr3: 18823159-18823263 [+]
Database links

Mature sequence gga-miR-194

Accession MIMAT0001133
Sequence

14 - 

uguaacagcaacuccaugugga

 - 35

Get sequence
Deep sequencing216 reads, 5 experiments
Evidence by similarity; MI0000488
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).