Stem-loop sequence gga-mir-217

AccessionMI0001201 (change log)
DescriptionGallus gallus miR-217 stem-loop
Gene family MIPF0000077; mir-217
Literature search

7 open access papers mention gga-mir-217
(12 sentences)

Stem-loop
   aaagucacugcaga   cuu     c c  a  c     c          u -   aau 
5'               guu   gaugu g ag ua ugcau aggaacugau g gau   a
                 |||   ||||| | || || ||||| |||||||||| | |||    
3'               caa   cuacg c uc gu acgua uccuugacua c cug   a
   -----------gaa   -au     a u  c  u     a          c a   acu 
Get sequence
Deep sequencing
1602 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 315408-315514 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-217
gga-mir-216cchr3: 323485-323570 [+]
gga-mir-216bchr3: 323483-323571 [-]
gga-mir-216achr3: 318076-318181 [-]
gga-mir-217chr3: 315408-315514 [-]
Database links

Mature sequence gga-miR-217-5p

Accession MIMAT0001132
Sequence

32 - 

uacugcaucaggaacugauuggau

 - 55

Get sequence
Deep sequencing1597 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-217-3p

Accession MIMAT0026513
Sequence

68 - 

ccaucaguuccuaaugcauugcc

 - 90

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).