Stem-loop sequence gga-mir-216a

AccessionMI0001200 (change log)
Previous IDsgga-mir-216
DescriptionGallus gallus miR-216 stem-loop
Gene family MIPF0000054; mir-216
Literature search

3 open access papers mention gga-mir-216a
(5 sentences)

Stem-loop
   --------------gaug      aa     u         cug  a        c   u 
5'                   gcugug  uuggc uaaucucag   gc acugugag agu a
                     ||||||  ||||| |||||||||   || |||||||| ||| a
3'                   cgacac  aaucg auuaggguc   ug ugacacuc uua u
   guaaucucguuucuuuaa      -a     u         -ua  g        -   a 
Get sequence
Deep sequencing
501 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 318076-318181 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-216a
gga-mir-216cchr3: 323485-323570 [+]
gga-mir-216bchr3: 323483-323571 [-]
gga-mir-216achr3: 318076-318181 [-]
gga-mir-217chr3: 315408-315514 [-]
Database links

Mature sequence gga-miR-216a

Accession MIMAT0001131
Previous IDsgga-miR-216
Sequence

19 - 

uaaucucagcuggcaacugug

 - 39

Get sequence
Deep sequencing498 reads, 5 experiments
Evidence by similarity; MI0000292
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).