Stem-loop sequence gga-mir-30b

AccessionMI0001199 (change log)
DescriptionGallus gallus miR-30b stem-loop
Gene family MIPF0000005; mir-30
Literature search

22 open access papers mention gga-mir-30b
(92 sentences)

Stem-loop
   -    cuu      ccu          u  -a       aua  a 
5'  cuaa   uuaguu   guaaacaucc ac  cucagcu   ac a
    ||||   ||||||   |||||||||| ||  |||||||   || g
3'  gguu   agucaa   cauuuguagg ug  gggucgg   ug u
   a    --c      cuu          -  gg       -ga  g 
Get sequence
Deep sequencing
23240 reads, 260 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 142757715-142757801 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-30b
gga-mir-30dchr2: 142761260-142761323 [-]
gga-mir-30bchr2: 142757715-142757801 [-]
Database links

Mature sequence gga-miR-30b-5p

Accession MIMAT0001130
Sequence

16 - 

uguaaacauccuacacucagcu

 - 37

Get sequence
Deep sequencing23157 reads, 5 experiments
Evidence experimental; cloned [1-3], Northern [1], Illumina [4]
Database links
Predicted targets

Mature sequence gga-miR-30b-3p

Accession MIMAT0026512
Sequence

54 - 

cugggggguggauguuuacuuc

 - 75

Get sequence
Deep sequencing77 reads, 5 experiments
Evidence experimental; Illumina [4]
Predicted targets

References

1
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
6
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
7
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).