Stem-loop sequence gga-mir-124a

AccessionMI0001197 (change log)
DescriptionGallus gallus miR-124a stem-loop
Gene family MIPF0000021; mir-124
Literature search

16 open access papers mention gga-mir-124a
(57 sentences)

Stem-loop
   ------------   c     c   cc        a   ga        uaau 
5'             agg ucugc ucu  guguucac gcg  ccuugauu    g
               ||| ||||| |||  |||||||| |||  ||||||||    u
3'             ucc aggcg aga  cguaagug cgc  ggaauuaa    c
   uuacggcggacc   u     -   ac        g   ac        caua 
Get sequence
Deep sequencing
182524 reads, 1.42e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 114701964-114702059 [+]
antisense
ENSGALT00000028996 ; gga-mir-124c-201; exon 1
Clustered miRNAs
< 10kb from gga-mir-124a
gga-mir-124cchr2: 114701957-114702057 [-]
gga-mir-124achr2: 114701964-114702059 [+]
gga-mir-1714chr2: 114704973-114705048 [+]
Database links

Mature sequence gga-miR-124a-5p

Accession MIMAT0026511
Sequence

18 - 

guucacagcggaccuugau

 - 36

Get sequence
Deep sequencing998 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-124a-3p

Accession MIMAT0001128
Sequence

51 - 

uuaaggcacgcggugaaugcca

 - 72

Get sequence
Deep sequencing364040 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).