Stem-loop sequence gga-mir-1a-2

AccessionMI0001196 (change log)
Previous IDsgga-mir-1-2
DescriptionGallus gallus miR-1a-2 stem-loop
Gene family MIPF0000038; mir-1
Literature search

28 open access papers mention gga-mir-1a-2
(196 sentences)

Stem-loop
   a      c    c                ac     ugaaca 
5'  ccugcu agag acauacuucuuuaugu  ccaua      u
    |||||| |||| ||||||||||||||||  |||||       
3'  ggacgg uuuu uguaugaagaaaugua  gguau      a
   c      u    a                -a     cguaac 
Get sequence
Deep sequencing
9112918 reads, 9.64e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 102815860-102815944 [-]
antisense
ENSGALT00000024152 ; MIB1-201; intron 12
Clustered miRNAs
< 10kb from gga-mir-1a-2
gga-mir-1a-2chr2: 102815860-102815944 [-]
gga-mir-133a-1chr2: 102812734-102812820 [-]
Database links

Mature sequence gga-miR-1a-2-5p

Accession MIMAT0026510
Sequence

14 - 

acauacuucuuuauguacccaua

 - 36

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-1a-3p

Accession MIMAT0001127
Previous IDsgga-miR-1
Sequence

53 - 

uggaauguaaagaaguaugua

 - 73

Get sequence
Deep sequencing18225317 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).