Stem-loop sequence gga-mir-133a-1

AccessionMI0001195 (change log)
DescriptionGallus gallus miR-133a-1 stem-loop
Gene family MIPF0000029; mir-133
Literature search

26 open access papers mention gga-mir-133a-1
(118 sentences)

Stem-loop
   -      uuu    a       aa  u  a        accuc 
5'  caaugc   gcua agcuggu  aa gg accaaauc     u
    ||||||   |||| |||||||  || || ||||||||      
3'  guuacg   cgau ucgacca  uu cc ugguuuag     u
   a      uau    g       ac  c  c        guaac 
Get sequence
Deep sequencing
23548 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 102812734-102812820 [-]
antisense
ENSGALT00000024152 ; MIB1-201; intron 12
Clustered miRNAs
< 10kb from gga-mir-133a-1
gga-mir-1a-2chr2: 102815860-102815944 [-]
gga-mir-133a-1chr2: 102812734-102812820 [-]
Database links

Mature sequence gga-miR-133a-5p

Accession MIMAT0026509
Sequence

15 - 

agcugguaaaauggaaccaaauc

 - 37

Get sequence
Deep sequencing5934 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-133a-3p

Accession MIMAT0001126
Sequence

53 - 

uugguccccuucaaccagcugu

 - 74

Get sequence
Deep sequencing41156 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).