Stem-loop sequence gga-mir-32

AccessionMI0001194 (change log)
DescriptionGallus gallus miR-32 stem-loop
Gene family MIPF0000069; mir-32
Literature search

4 open access papers mention gga-mir-32
(7 sentences)

Stem-loop
   -    a          u           -  uu  c 
5'  ggag uauugcacau acuaaguugca ug  gu a
    |||| |||||||||| ||||||||||| ||  ||  
3'  uuuc auagcgugug ugauuuaacgu ac  cg c
   c    -          -           g  uc  g 
Get sequence
Deep sequencing
14566 reads, 200 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 84498503-84498572 [-]
sense
ENSGALT00000021448 ; TMEM245-201; intron 23
Database links

Mature sequence gga-miR-32-5p

Accession MIMAT0001125
Sequence

6 - 

uauugcacauuacuaaguugc

 - 26

Get sequence
Deep sequencing14289 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-miR-32-3p

Accession MIMAT0026508
Sequence

48 - 

aauuuagugugugcgauacu

 - 67

Get sequence
Deep sequencing273 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).